Sequence Surrounding the Cloning Sites

 

 

GTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATA 60

5-end of enhancer region

GCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGC 120

CCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAG 180

GGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTAC 240

ATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGGCCCG 300

CCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACG 360

TATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGAT 420

AGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGT 480

TTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGCCCCGTTGACGC 540

TATA Box

AAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACC 600

Transcription start KpnI M G Y D V P D Y

GTCAGATCTCTAGAAGCTG GGT ACC gaa atg gga tac gat gtt cca gat tac

A S Y D V P D Y A S L

gct tcg tac gat gtt cca gat tac gcA AGC TTG CTA GCG GCC GCT

Hind III Nhe I Not I

CGA GGC CGG CAA GGC CGG ATC CA 720

Xho I BamH I

GACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAA 780

TGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAAT 840

AAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGG 900

GAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCGGCT 960

 

 

 

Unique enzymes in pHAHA:

 

SnaB I TAC|GTA 360

Acc65 I G`GTAC,C 621

Asp718 G`GTAC,C 621

Kpn I G,GTAC`C 625

BsiW I C`GTAC,G 658

Spl I C`GTAC,G 658

HinD III A`AGCT,T 680

Nhe I G`CTAG,C 686

Not I GC`GGCC,GC 691

PaeR7 I C`TCGA,G 697

Xho I C`TCGA,G 697

NgoM I G`CCGG,C 703

Nae I GCC|GGC 705

Sfi I GGCCN,NNN`NGGCC 709

BamH I G`GATC,C 715

EcoR V GAT|ATC 1705

Nsi I A,TGCA`T 3256

Avr II C`CTAG,G 5548

Stu I AGG|CCT 5837

BstE II G`GTNAC,C 5913

Xmn I GAANN|NNTTC 6404

Ple I GAGTC 9/10 7013

Nru I TCG|CGA 8005

BsiC I TT`CG,AA 8306

BstB I TT`CG,AA 8306

BsrG I T`GTAC,A 10194

Number of enzymes = 26

 

The following enzymes do not cut in pHAHA:

 

Afl II Age I Asc I Bbe I Bcl I

Blp I BssH II Bst1107 I Eco47 III Eco72 I

Ehe I Esp I Fse I Kas I Nar I

Pme I Pml I Pvu II Sap I Sph I

 

pHAHA: sites sorted by name:

 

Aat II (6) 145 198 281 467

6085 8482

Acc I (3) 1111 3586 9994

Acc65 I (1) 621

Aci I (98) 78 106 118 132

265 299 390 423

527 548 690 694

1039 1075 1085 1133

1181 1516 1810 2265

2400 2407 2457 2469

2535 3314 3477 3610

3732 3734 3827 3930

4276 4406 4533 5306

5416 5437 5509 5794

5960 6113 6160 6259

6368 6445 6489 6610

6656 6847 6938 7300

7309 7444 7554 7675

7694 7821 7849 7939

7954 8051 8057 8073

8126 8180 8222 8279

8329 8334 8405 8429

8474 8598 8663 8730

8780 8800 8824 8846

8866 9043 9081 9091

9204 9232 9234 9255

9384 9394 9523 9589

9656 9729 9895 9965

9969 10226

Afl III (4) 1243 1435 2381 8366

Aha II (13) 142 195 278 464

1069 1935 2253 3644

6082 6464 8479 9447

9925

Ahd I (2) 2103 7004

Alu I (33) 586 617 682 834

1008 1027 1413 1505

1722 1864 3482 3793

4130 5953 5977 5992

6651 6714 6814 7335

7592 7638 7728 7889

8535 8567 8609 8994

9219 9284 9313 9989

10017

Alw I (21) 711 722 948 1129

5402 5713 5978 6364

6370 6685 7149 7150

7247 7247 7333 8429

8915 9233 9342 9472

10025

AlwN I (4) 1795 5566 7483 9738

Apa I (4) 1235 1454 2328 4283

ApaL I (5) 1313 6332 7578 8735

9037

Apo I (11) 795 1949 2119 3336

3385 4156 5731 5842

6006 8302 8698

Ase I (2) 27 6829

Asp718 (1) 621

Ava I (9) 697 1591 2507 4238

4297 5419 5886 8040

8437

Ava II (23) 1260 1518 1687 2193

2619 3846 3950 4243

5337 5500 5524 5563

5890 6640 6862 8336

8343 8863 9404 9598

9774 9838 9892

Avr II (1) 5548

BamH I (1) 715

Ban I (6) 485 621 2502 7051

8176 9029

Ban II (9) 588 1235 1454 2312

2328 4132 4283 5427

9712

Bbs I (3) 1465 5425 6021

Bbv I (15) 1017 1111 2274 3749

5358 5790 6772 6961

7563 8409 8544 8802

9195 9322 9726

Bbv II (3) 1464 5426 6020

Bcn I (32) 1013 1048 1139 1593

1594 2509 2510 2906

3232 3949 4240 4241

4299 4300 4418 4531

4558 4582 4606 5421

5422 5784 6469 6820

7516 8232 8439 8440

9242 9358 9923 10035

Bfa I (13) 20 611 687 762

1117 2028 2148 4118

5549 6811 7146 7399

9990

Bgl I (8) 110 232 303 709

1066 1230 2323 6886

Bgl II (2) 605 10083

Bpm I (7) 1367 2588 4412 6935

8085 9123 9177

Bsa I (4) 4406 5380 6938 9626

BsaA I (2) 360 4110

BsaB I (2) 951 2107

BsaH I (13) 142 195 278 464

1069 1935 2253 3644

6082 6464 8479 9447

9925

BsaJ I (54) 380 1136 1445 1446

1453 1591 2012 2073

2184 2506 2507 2508

2666 3324 3732 3763

3953 4237 4238 4239

4264 4297 4298 4446

4481 4505 4528 4555

4579 4603 5332 5419

5420 5473 5548 7732

8096 8196 8229 8339

8437 8438 8807 9008

9163 9232 9601 9602

9704 9705 9757 9780

9866 9883

BsaW I (9) 5378 6708 7539 7686

8676 9213 9349 9462

9511

BseR I (20) 4538 4562 4586 4637

4736 4763 4916 4982

5018 5045 5063 5099

5126 5144 5180 5198

5243 5261 5432 5887

Bsg I (2) 3779 5674

BsiC I (1) 8306

BsiE I (9) 694 6486 6635 7558

8663 8798 8819 8828

9398

BsiHKA I (10) 588 1317 1914 2649

4132 6336 6421 7582

8739 9041

BsiW I (1) 658

Bsm I (3) 771 864 8112

BsmA I (13) 453 1010 2285 3650

3968 4407 5379 5539

6163 6937 8522 9498

9627

BsmB I (4) 1009 3651 3967 8523

BsmF I (18) 195 346 514 1273

1446 2097 2167 2206

4454 5323 5836 5903

7877 8212 9372 9584

9760 9781

BsoF I (56) 691 694 835 960

1006 1100 2263 2400

2560 3314 3345 3735

3738 3794 4534 5347

5416 5509 5779 5961

6260 6489 6584 6611

6761 6950 7278 7484

7487 7552 7695 7850

7954 8051 8058 8061

8180 8330 8398 8429

8533 8610 8663 8791

8822 8825 9081 9184

9232 9235 9311 9395

9715 9730 9935 10055

Bsp120 I (4) 1231 1450 2324 4279

Bsp1286 I (2) 2649 6421

BspH I (3) 6059 6164 7172

BspM I (4) 2526 3808 7921 8768

BspM II (5) 5378 8676 9213 9349

9462

Bsr I (24) 316 1232 2103 2167

2278 3279 3593 4247

4441 5937 6358 6530

6797 6840 6958 7364

7478 7491 8940 9105

9754 9850 9907 10072

BsrB I (7) 696 1810 3827 5308

6162 8846 9204

BsrD I (7) 1382 4152 6770 6944

8452 10049 10163

BsrG I (1) 10194

BssS I (7) 1757 2631 6028 6335

7719 8555 9034

BstB I (1) 8306

BstE II (1) 5913

BstN I (29) 110 303 1346 1447

1455 2186 3399 3432

3764 3936 3954 4123

4265 4391 4447 4483

4507 5429 5561 5573

5722 5834 7733 7746

7867 7918 9603 9706

9884

BstU I (39) 80 967 969 1181

2383 2553 3460 3477

3734 4406 6113 6445

6938 7268 7849 7939

8000 8005 8032 8053

8079 8212 8334 8368

8476 8665 8800 8911

8977 9043 9192 9234

9394 9525 9589 9658

9909 9967 9969

BstX I (4) 2320 2693 2989 4334

BstY I (12) 605 715 5717 6357

6374 7142 7154 7240

7251 8433 10029 10083

Bsu36 I (2) 1691 4028

Cac8 I (37) 106 299 680 684

688 705 1812 1839

2381 2537 3576 3829

3932 4402 6758 6891

7282 7842 7879 7932

7941 8013 8055 8210

8220 8426 8780 8981

9041 9221 9384 9609

9656 9712 9734 9982

10059

Cfr10 I (4) 703 4072 6919 8793

Cla I (2) 1125 5982

Csp6 I (15) 238 318 351 402

559 622 659 1215

1439 5569 6522 9371

9424 9901 10195

Dde I (20) 1330 1691 1880 2595

2641 3378 3483 3871

3926 4028 5411 5636

5821 6077 6503 7043

7209 7618 8833 9852

Dpn I (34) 607 717 954 1124

1802 2565 5408 5609

5719 5973 6323 6359

6376 6634 6680 6698

7039 7144 7156 7234

7242 7253 7328 8435

8500 8633 8818 8831

8921 9228 9348 9467

10031 10085

DpnII (34) 605 715 952 1122

1800 2563 5406 5607

5717 5971 6321 6357

6374 6632 6678 6696

7037 7142 7154 7232

7240 7251 7326 8433

8498 8631 8816 8829

8919 9226 9346 9465

10029 10083

Dra I (4) 911 6426 7118 7137

Dra III (3) 1333 8743 9036

Drd I (6) 1061 1360 4241 7790

8959 9340

Dsa I (13) 380 2073 2666 3732

5332 5473 8196 8807

9163 9232 9757 9780

9866

Eae I (9) 691 2345 3554 6611

8660 8825 9078 9395

10160

Eag I (4) 691 8660 8825 9395

Ear I (5) 5462 5495 5905 5911

6205

Eco57 I (5) 1188 1428 1816 6337

7351

EcoN I (2) 5908 6643

EcoO109 I (16) 1232 1450 1494 1554

1687 2324 3846 4279

4280 4398 5337 5563

5890 6024 9735 9774

EcoR I (3) 6006 8302 8698

EcoR II (29) 108 301 1344 1445

1453 2184 3397 3430

3762 3934 3952 4121

4263 4389 4445 4481

4505 5427 5559 5571

5720 5832 7731 7744

7865 7916 9601 9704

9882

EcoR V (1) 1705

Fnu4H I (56) 691 694 835 960

1006 1100 2263 2400

2560 3314 3345 3735

3738 3794 4534 5347

5416 5509 5779 5961

6260 6489 6584 6611

6761 6950 7278 7484

7487 7552 7695 7850

7954 8051 8058 8061

8180 8330 8398 8429

8533 8610 8663 8791

8822 8825 9081 9184

9232 9235 9311 9395

9715 9730 9935 10055

Fok I (21) 1054 1282 1322 1328

2115 3844 4432 5677

5725 5737 5788 5888

6565 6852 7033 7930

7975 8177 8824 9197

9890

Fsp I (2) 6781 8111

Gdi II (10) 690 692 6612 8659

8661 8824 8826 9077

9394 9396

Gsu I (7) 1366 2587 4411 6934

8084 9122 9176

Hae I (15) 2347 3397 3556 4382

5553 5837 7418 7870

7881 7930 7987 8375

8806 9882 10162

Hae II (2) 2602 7652

Hae III (59) 104 297 693 703

712 1233 1452 1496

1555 2326 2347 2539

3397 3556 3934 3946

3959 4257 4281 4326

4382 4400 4451 4536

4560 4584 4608 5402

5553 5576 5837 5963

6026 6613 6880 6960

7418 7852 7870 7881

7930 7987 8038 8201

8375 8662 8806 8827

8855 9007 9080 9162

9397 9646 9703 9736

9754 9882 10162

Hga I (23) 545 1059 1942 2260

2373 3634 5640 5806

6471 7203 7781 7990

8022 8084 8276 8373

8405 8506 8958 9197

9342 9454 9915

HgiA I (10) 588 1317 1914 2649

4132 6336 6421 7582

8739 9041

HgiE II (2) 2193 7303

Hha I (32) 969 1099 2553 2593

2601 3477 4216 4406

6113 6445 6782 6875

7268 7377 7551 7651

7718 8032 8050 8112

8334 8614 8667 8911

8979 9194 9321 9394

9527 9909 9969 10063

HinC II (10) 4 536 850 1112

1293 1565 6462 8419

9291 9995

Hind II (10) 4 536 850 1112

1293 1565 6462 8419

9291 9995

HinD III (1) 680

Hinf I (21) 430 1113 1752 1829

2268 3920 3978 4113

4442 5592 5658 5882

7005 7522 7970 8162

8551 8673 8873 9124

10096

HinI I (13) 142 195 278 464

1069 1935 2253 3644

6082 6464 8479 9447

9925

HinP I (32) 967 1097 2551 2591

2599 3475 4214 4404

6111 6443 6780 6873

7266 7375 7549 7649

7716 8030 8048 8110

8332 8612 8665 8909

8977 9192 9319 9392

9525 9907 9967 10061

Hpa I (2) 850 1565

Hpa II (46) 704 713 956 1012

1046 1138 1592 2508

2904 3230 3947 4073

4239 4298 4417 4530

4557 4581 4605 5379

5420 5512 5783 6467

6709 6819 6886 6920

7324 7514 7540 7687

7957 8231 8438 8677

8794 9027 9214 9240

9350 9356 9463 9512

9921 10033

Hph I (26) 395 987 996 1942

2215 3393 3421 3551

3673 3688 3718 3797

4221 4308 5475 5758

5908 6278 6311 6519

6933 7160 8170 8373

8464 9707

Kpn I (1) 625

Mae I (13) 20 611 687 762

1117 2028 2148 4118

5549 6811 7146 7399

9990

Mae II (23) 142 154 195 278

359 464 1481 3490

4109 4306 4464 4518

5364 6082 6402 6775

7191 8020 8479 8749

9721 10040 10172

Mae III (30) 81 168 820 1020

1246 1396 1640 1724

1779 1931 2216 2230

2450 3486 3491 3540

3657 3802 4110 5913

6343 6531 6684 6742

7073 7356 7472 7535

8362 8745

Mbo I (34) 605 715 952 1122

1800 2563 5406 5607

5717 5971 6321 6357

6374 6632 6678 6696

7037 7142 7154 7232

7240 7251 7326 8433

8498 8631 8816 8829

8919 9226 9346 9465

10029 10083

Mbo II (24) 1169 1469 1809 1825

1837 5426 5450 5483

5893 5899 5956 6025

6221 6330 6408 7163

7236 7978 8245 8559

9142 9145 9656 10092

Mlu I (2) 2381 8366

Mme I (7) 3478 4147 5695 7500

7684 8545 9079

Mnl I (162) 561 693 886 895

934 972 1002 1100

1113 1451 1462 1484

1521 1531 1753 1900

2010 2563 2627 2631

3257 3329 3387 3521

3633 3687 3693 3707

3738 3761 3879 4031

4036 4064 4181 4212

4231 4387 4461 4483

4531 4546 4555 4558

4570 4579 4582 4594

4603 4606 4618 4624

4639 4654 4657 4672

4681 4696 4705 4720

4729 4744 4753 4756

4771 4780 4783 4798

4807 4822 4831 4846

4855 4870 4885 4900

4915 4924 4933 4936

4951 4966 4975 4984

4999 5002 5017 5026

5035 5038 5053 5062

5065 5080 5083 5098

5107 5116 5119 5134

5143 5146 5161 5164

5179 5188 5197 5200

5215 5218 5233 5242

5251 5260 5263 5278

5281 5296 5311 5449

5452 5458 5464 5476

5491 5497 5588 5678

5697 5751 5763 5769

5814 5835 5847 5856

5904 5907 5913 5962

6036 6631 6837 6983

7064 7464 7715 7788

8005 8167 8334 8385

8535 8572 8796 9003

9042 9102 9129 9152

9200 9474

Msc I (3) 2347 3556 10162

Mse I (22) 27 849 910 1564

2059 2173 2301 3389

3629 3851 4134 6053

6425 6790 6829 7064

7117 7131 7136 7188

8358 8409

Msl I (7) 385 3503 5391 6233

6592 7948 8195

Msp I (46) 704 713 956 1012

1046 1138 1592 2508

2904 3230 3947 4073

4239 4298 4417 4530

4557 4581 4605 5379

5420 5512 5783 6467

6709 6819 6886 6920

7324 7514 7540 7687

7957 8231 8438 8677

8794 9027 9214 9240

9350 9356 9463 9512

9921 10033

MspA1 I (10) 1075 2265 3734 5796

6368 7309 7554 8782

9091 9234

Mun I (2) 859 3511

Nae I (1) 705

Nci I (32) 1012 1047 1138 1592

1593 2508 2509 2905

3231 3948 4239 4240

4298 4299 4417 4530

4557 4581 4605 5420

5421 5783 6468 6819

7515 8231 8438 8439

9241 9357 9922 10034

Nco I (7) 380 2073 2666 5473

8807 9780 9866

Nde I (16) 254 1583 1637 1658

2703 2763 2853 2913

2999 3029 3089 3179

3239 3269 3309 8905

NgoM I (1) 703

Nhe I (1) 686

Nla III (41) 324 384 727 1005

1107 1195 1247 1439

1720 1744 2077 2214

2670 3254 3418 3502

3523 3582 3904 5477

5592 5703 6004 6063

6168 6561 6597 6675

6685 7176 7929 8252

8811 8894 8929 9784

9870 9892 9901 10009

10215

Nla IV (50) 487 623 717 1233

1261 1451 1452 1495

1520 1556 1688 2194

2311 2325 2326 2504

3951 3958 4170 4244

4280 4281 4399 5338

5339 5426 5516 5577

5891 5892 6117 6707

6918 6959 7053 7825

7864 8039 8143 8178

9031 9054 9238 9354

9520 9600 9645 9755

9775 9776

Not I (1) 691

Nru I (1) 8005

Nsi I (1) 3256

Nsp7524 I (7) 1001 1191 1243 1435

3414 8248 9897

NspB II (10) 1075 2265 3734 5796

6368 7309 7554 8782

9091 9234

NspH I (7) 1005 1195 1247 1439

3418 8252 9901

PaeR7 I (1) 697

Pal I (59) 104 297 693 703

712 1233 1452 1496

1555 2326 2347 2539

3397 3556 3934 3946

3959 4257 4281 4326

4382 4400 4451 4536

4560 4584 4608 5402

5553 5576 5837 5963

6026 6613 6880 6960

7418 7852 7870 7881

7930 7987 8038 8201

8375 8662 8806 8827

8855 9007 9080 9162

9397 9646 9703 9736

9754 9882 10162

PflM I (5) 2079 3941 4252 8102

8151

Ple I (1) 7013

PpuM I (6) 1687 3846 5337 5563

5890 9774

Psp1406 I (3) 6402 6775 10040

PspA I (6) 1591 2507 4238 4297

5419 8437

Pst I (4) 6762 8399 8792 10059

Pvu I (2) 6635 8819

Rsa I (15) 239 319 352 403

560 623 660 1216

1440 5570 6523 9372

9425 9902 10196

Rsr II (2) 8336 8863

Sac I (2) 588 4132

Sac II (2) 3735 9235

Sal I (2) 1110 9993

Sau3A I (34) 605 715 952 1122

1800 2563 5406 5607

5717 5971 6321 6357

6374 6632 6678 6696

7037 7142 7154 7232

7240 7251 7326 8433

8498 8631 8816 8829

8919 9226 9346 9465

10029 10083

Sau96 I (56) 103 296 1231 1232

1260 1450 1451 1494

1518 1554 1687 2193

2324 2325 2537 2619

3846 3932 3944 3950

3957 4243 4255 4279

4280 4324 4398 4449

5337 5401 5500 5524

5563 5575 5890 6024

6640 6862 6879 6958

8037 8200 8336 8343

8854 8863 9005 9404

9598 9644 9702 9735

9753 9774 9838 9892

Sca I (2) 6523 9425

ScrF I (61) 110 303 1012 1047

1138 1346 1447 1455

1592 1593 2186 2508

2509 2905 3231 3399

3432 3764 3936 3948

3954 4123 4239 4240

4265 4298 4299 4391

4417 4447 4483 4507

4530 4557 4581 4605

5420 5421 5429 5561

5573 5722 5783 5834

6468 6819 7515 7733

7746 7867 7918 8231

8438 8439 9241 9357

9603 9706 9884 9922

10034

Sec I (54) 380 1136 1445 1446

1453 1591 2012 2073

2184 2506 2507 2508

2666 3324 3732 3763

3953 4237 4238 4239

4264 4297 4298 4446

4481 4505 4528 4555

4579 4603 5332 5419

5420 5473 5548 7732

8096 8196 8229 8339

8437 8438 8807 9008

9163 9232 9601 9602

9704 9705 9757 9780

9866 9883

SfaN I (23) 378 794 1033 1118

3865 4176 5918 6304

6551 6744 7796 7941

7951 8036 8308 8520

8664 8731 8803 8988

9218 9298 9320

Sfc I (8) 1286 4364 6758 7436

7627 8395 8788 10055

Sfi I (1) 709

Sma I (6) 1593 2509 4240 4299

5421 8439

SnaB I (1) 360

Spe I (2) 19 2027

Spl I (1) 658

Ssp I (3) 6199 10103 10150

Stu I (1) 5837

Sty I (11) 380 2012 2073 2666

3324 5473 5548 8096

8807 9780 9866

Taq I (23) 698 1111 1125 1666

1914 4551 4575 4599

5982 6350 7794 8306

8378 8486 8501 8510

8570 8987 9200 9302

9327 9619 9994

Tfi I (11) 1752 1829 5592 5882

7970 8162 8551 8673

8873 9124 10096

Tsp45 I (15) 1020 1246 1724 1779

1931 3486 3491 3540

3802 4110 5913 6531

6742 8362 8745

Tth111 I (3) 8515 8959 9772

Tth111 II (11) 1279 2618 3337 4241

6012 7270 7300 7309

8675 9954 9999

Vsp I (2) 27 6829

Xba I (2) 610 1116

Xcm I (3) 3285 4334 9755

Xho I (1) 697

Xho II (12) 605 715 5717 6357

6374 7142 7154 7240

7251 8433 10029 10083

Xma I (6) 1591 2507 4238 4297

5419 8437

Xma III (4) 691 8660 8825 9395

Xmn I (1) 6404

 

Site usage in pHAHA:

 

Aat II G,ACGT`C 6 Acc I GT`MK,AC 3

Acc65 I G`GTAC,C 1 Aci I C`CG,C 98

Afl II C`TTAA,G - Afl III A`CRYG,T 4

Age I A`CCGG,T - Aha II GR`CG,YC 13

Ahd I GACNN,N`NNGTC 2 Alu I AG|CT 33

Alw I GGATC 8/9 21 AlwN I CAG,NNN`CTG 4

Apa I G,GGCC`C 4 ApaL I G`TGCA,C 5

Apo I R`AATT,Y 11 Asc I GG`CGCG,CC -

Ase I AT`TA,AT 2 Asp718 G`GTAC,C 1

Ava I C`YCGR,G 9 Ava II G`GWC,C 23

Avr II C`CTAG,G 1 BamH I G`GATC,C 1

Ban I G`GYRC,C 6 Ban II G,RGCY`C 9

Bbe I G,GCGC`C - Bbs I GAAGAC 8/12 3

Bbv I GCAGC 13/17 15 Bbv II GAAGAC 7/11 3

Bcl I T`GATC,A - Bcn I CC,S`GG 32

Bfa I C`TA,G 13 Bgl I GCCN,NNN`NGGC 8

Bgl II A`GATC,T 2 Blp I GC`TNA,GC -

Bpm I CTGGAG 22/20 7 Bsa I GGTCTC 7/11 4

BsaA I YAC|GTR 2 BsaB I GATNN|NNATC 2

BsaH I GR`CG,YC 13 BsaJ I C`CNNG,G 54

BsaW I W`CCGG,W 9 BseR I GAGGAG 16/14 20

Bsg I GTGCAG 22/20 2 BsiC I TT`CG,AA 1

BsiE I CG,RY`CG 9 BsiHKA I G,WGCW`C 10

BsiW I C`GTAC,G 1 Bsm I GAATG,C 7 3

BsmA I GTCTC`/9 13 BsmB I CGTCTC 7/11 4

BsmF I GGGAC 15/19 18 BsoF I GC`N,GC 56

Bsp120 I G`GGCC,C 4 Bsp1286 I G,DGCH`C 2

BspH I T`CATG,A 3 BspM I ACCTGC 10/14 4

BspM II T`CCGG,A 5 Bsr I ACT,GG` 24

BsrB I GAG|CGG 7 BsrD I GCAATG, 8 7

BsrG I T`GTAC,A 1 BssH II G`CGCG,C -

BssS I C`TCGT,G 7 Bst1107 I GTA|TAC -

BstB I TT`CG,AA 1 BstE II G`GTNAC,C 1

BstN I CC`W,GG 29 BstU I CG|CG 39

BstX I CCAN,NNNN`NTGG 4 BstY I R`GATC,Y 12

Bsu36 I CC`TNA,GG 2 Cac8 I GCN|NGC 37

Cfr10 I R`CCGG,Y 4 Cla I AT`CG,AT 2

Csp6 I G`TA,C 15 Dde I C`TNA,G 20

Dpn I GA|TC 34 DpnII `GATC, 34

Dra I TTT|AAA 4 Dra III CAC,NNN`GTG 3

Drd I GACNN,NN`NNGTC 6 Dsa I C`CRYG,G 13

Eae I Y`GGCC,R 9 Eag I C`GGCC,G 4

Ear I CTCTTC 7/10 5 Eco47 III AGC|GCT -

Eco57 I CTGAAG 21/19 5 Eco72 I CAC|GTG -

EcoN I CCTNN`N,NNAGG 2 EcoO109 I RG`GNC,CY 16

EcoR I G`AATT,C 3 EcoR II `CCWGG, 29

EcoR V GAT|ATC 1 Ehe I GGC|GCC -

Esp I GC`TNA,GC - Fnu4H I GC`N,GC 56

Fok I GGATG 14/18 21 Fse I GG,CCGG`CC -

Fsp I TGC|GCA 2 Gdi II `YGGC,CG 10

Gsu I CTGGAG 21/19 7 Hae I WGG|CCW 15

Hae II R,GCGC`Y 2 Hae III GG|CC 59

Hga I GACGC 9/14 23 HgiA I G,WGCW`C 10

HgiE II ACCNNNNNNGGT -1/132 Hha I G,CG`C 32

HinC II GTY|RAC 10 Hind II GTY|RAC 10

HinD III A`AGCT,T 1 Hinf I G`ANT,C 21

HinI I GR`CG,YC 13 HinP I G`CG,C 32

Hpa I GTT|AAC 2 Hpa II C`CG,G 46

Hph I GGTGA 12/11 26 Kas I G`GCGC,C -

Kpn I G,GTAC`C 1 Mae I C`TA,G 13

Mae II A`CG,T 23 Mae III `GTNAC, 30

Mbo I `GATC, 34 Mbo II GAAGA 12/11 24

Mlu I A`CGCG,T 2 Mme I TCCRAC 25/23 7

Mnl I CCTC 10/10 162 Msc I TGG|CCA 3

Mse I T`TA,A 22 Msl I CAYNN|NNRTG 7

Msp I C`CG,G 46 MspA1 I CMG|CKG 10

Mun I C`AATT,G 2 Nae I GCC|GGC 1

Nar I GG`CG,CC - Nci I CC`S,GG 32

Nco I C`CATG,G 7 Nde I CA`TA,TG 16

NgoM I G`CCGG,C 1 Nhe I G`CTAG,C 1

Nla III ,CATG` 41 Nla IV GGN|NCC 50

Not I GC`GGCC,GC 1 Nru I TCG|CGA 1

Nsi I A,TGCA`T 1 Nsp7524 I R`CATG,Y 7

NspB II CMG|CKG 10 NspH I R,CATG`Y 7

PaeR7 I C`TCGA,G 1 Pal I GG|CC 59

PflM I CCAN,NNN`NTGG 5 Ple I GAGTC 9/10 1

Pme I CTTT|AAAC - Pml I CAC|GTG -

PpuM I RG`GWC,CY 6 Psp1406 I AA`CG,TT 3

PspA I C`CCGG,G 6 Pst I C,TGCA`G 4

Pvu I CG,AT`CG 2 Pvu II CAG|CTG -

Rsa I GT|AC 15 Rsr II CG`GWC,CG 2

Sac I G,AGCT`C 2 Sac II CC,GC`GG 2

Sal I G`TCGA,C 2 Sap I GCTCTTC 8/11 -

Sau3A I `GATC, 34 Sau96 I G`GNC,C 56

Sca I AGT|ACT 2 ScrF I CC`N,GG 61

Sec I C`CNNG,G 54 SfaN I GCATC 9/13 23

Sfc I C`TRYA,G 8 Sfi I GGCCN,NNN`NGGCC 1

Sma I CCC|GGG 6 SnaB I TAC|GTA 1

Spe I A`CTAG,T 2 Sph I G,CATG`C -

Spl I C`GTAC,G 1 Srf I GCCC|GGGC -

Ssp I AAT|ATT 3 Stu I AGG|CCT 1

Sty I C`CWWG,G 11 Taq I T`CG,A 23

Tfi I G`AWT,C 11 Tsp45 I `GTSAC, 15

Tth111 I GACN`N,NGTC 3 Tth111 II CAARCA 16/14 11

Vsp I AT`TA,AT 2 Xba I T`CTAG,A 2

Xca I GTA|TAC - Xcm I CCANNNN,N`NNNNTGG3

Xho I C`TCGA,G 1 Xho II R`GATC,Y 12

Xma I C`CCGG,G 6 Xma III C`GGCC,G 4