Multiple Cloning Site Sequence

 

                          Xho I      HinD III                               Sac II

      Bgl II      Sac I           EcoR I       Sal I       Kpn I

       End of mRFP    |   |      |     |         |            |           |  |

1262 tcc acc ggc gcc AGA TCT CGA GCT CAA GCT TCG AAT TCT GCA GTC GAC GGT ACC GCG GG

     Ser Thr Gly Ala  

               

   Sma I

Xma I  BamH I      Xba I (methylated)

  | |  |               |

C CCG GGA TCC ACC GGA TCT AGA TAA CTG ATC ATAATCAGCCATACCACATTTGTAGAGGT  1380

 

 

 

Unique enzymes in pMRFP-C1:

 

Ase I       AT`TA,AT        8

Vsp I       AT`TA,AT        8

Nde I       CA`TA,TG        235

SnaB I      TAC|GTA         341

Ahd I       GACNN,N`NNGTC   779

Bbv II      GAAGAC 7/11     1019

Bbs I       GAAGAC 8/12     1020

PflM I      CCAN,NNN`NTGG   1024

BstX I      CCAN,NNNN`NTGG  1142

Bsg I       GTGCAG 22/20    1179

BssH II     G`CGCG,C        1244

Bgl II      A`GATC,T        1275

PaeR7 I     C`TCGA,G        1279

Xho I       C`TCGA,G        1279

Sac I       G,AGCT`C        1286

HinD III    A`AGCT,T        1288

EcoR I      G`AATT,C        1295

Sal I       G`TCGA,C        1305

Acc I       GT`MK,AC        1306

Acc65 I     G`GTAC,C        1311

Asp718      G`GTAC,C        1311

Kpn I       G,GTAC`C        1315

Sac II      CC,GC`GG        1318

Bsp120 I    G`GGCC,C        1319

PspA I      C`CCGG,G        1322

Xma I       C`CCGG,G        1322

Apa I       G,GGCC`C        1323

Sma I       CCC|GGG         1324

BamH I      G`GATC,C        1326

Xba I       T`CTAG,A        1338

Bcl I       T`GATC,A        1348

Mun I       C`AATT,G        1441

Hpa I       GTT|AAC         1454

Mlu I       A`CGCG,T        1577

Dra III     CAC,NNN`GTG     1807

Sfi I       GGCCN,NNN`NGGCC 2466

Cla I       AT`CG,AT        2531

Eag I       C`GGCC,G        2597

Xma III     C`GGCC,G        2597

Tth111 I    GACN`N,NGTC     2809

BsrD I      GCAATG, 8       2924

Bsp1286 I   G,DGCH`C        2994

Rsr II      CG`GWC,CG       3207

Bsa I       GGTCTC 7/11     3680

EcoO109 I   RG`GNC,CY       3789

HgiE II     ACCNNNNNNGGT -1/134020

ApaL I      G`TGCA,C        4295

Number of enzymes = 47

 

The following enzymes do not cut in pMRFP-C1:

 

Afl II      Age I       Asc I       Blp I       BsiW I

BsmB I      BspM II     BsrG I      Bst1107 I   Eco47 III

Eco72 I     EcoN I      EcoR V      Esp I       Fse I

Nhe I       Not I       Nru I       Pme I       Pml I

PpuM I      Psp1406 I   Pvu I       Sca I       Spe I

Spl I       Srf I       Xca I       Xcm I       Xmn I

 

pMRFP-C1: sites sorted by name:

 

Aat II      (5)   126      179      262      448

                  619

Acc I       (1)   1306

Acc65 I     (1)   1311

Aci I       (65)  59       87       99       113

                  280      371      404      508

                  529      590      704      727

                  751      826      904      973

                  1043     1108     1256     1315

                  1317     1951     1978     2006

                  2009     2023     2066     2113

                  2176     2361     2373     2382

                  2394     2404     2415     2461

                  2600     2663     2757     2821

                  2922     2925     3165     3205

                  3210     3260     3276     3302

                  3358     3427     3430     3496

                  3578     3643     3710     3783

                  4017     4026     4161     4271

                  4392     4411     4538     4566

                  4657

Afl III     (2)   1577     4609

Aha II      (12)  123      176      259      445

                  616      1063     1120     1171

                  1270     2691     3393     3472

Ahd I       (1)   779

Alu I       (20)  567      734      851      968

                  1097     1163     1193     1284

                  1290     1470     1637     1894

                  2189     2477     2797     3255

                  4052     4309     4355     4445

Alw I       (15)  582      1322     1333     1342

                  2558     2869     2936     3115

                  3480     3507     3866     3867

                  3964     3964     4050

AlwN I      (2)   3792     4200

Apa I       (1)   1323

ApaL I      (1)   4295

Apo I       (4)   1295     1505     1609     1620

Ase I       (1)   8

Asp718      (1)   1311

Ava I       (4)   861      1053     1279     1322

Ava II      (2)   3207     3652

Avr II      (2)   2513     3528

BamH I      (1)   1326

Ban I       (10)  466      717      975      1062

                  1170     1269     1311     1844

                  2690     2725

Ban II      (6)   660      1286     1323     1882

                  3056     3766

Bbe I       (4)   1066     1174     1273     2694

Bbs I       (1)   1020

Bbv I       (7)   1172     1479     2764     2806

                  3327     3780     4280

Bbv II      (1)   1019

Bcl I       (1)   1348

Bcn I       (7)   1169     1324     1325     2696

                  2856     3469     4233

Bfa I       (8)   593      1339     1540     1958

                  2514     3529     3863     4116

Bgl I       (4)   91       213      284      2466

Bgl II      (1)   1275

Bpm I       (2)   3474     3531

Bsa I       (1)   3680

BsaA I      (4)   341      815      1807     2995

BsaB I      (2)   1353     2550

BsaH I      (12)  123      176      259      445

                  616      1063     1120     1171

                  1270     2691     3393     3472

BsaJ I      (28)  361      598      610      745

                  769      805      862      922

                  1018     1054     1123     1249

                  1315     1322     2225     2297

                  2420     2455     2464     2513

                  2854     3123     3528     3655

                  3656     3758     3759     4449

BsaW I      (5)   1332     2722     3566     4256

                  4403

BseR I      (3)   596      920      2509

Bsg I       (1)   1179

BsiC I      (2)   1293     3373

BsiE I      (2)   2600     4275

BsiHKA I    (4)   1286     2804     2994     4299

Bsm I       (2)   1442     1535

BsmA I      (5)   434      2116     2534     3553

                  3681

BsmF I      (12)  176      327      495      767

                  786      2207     2279     2343

                  2842     3374     3483     3638

BsoF I      (37)  704      752      905      969

                  974      1109     1161     1164

                  1256     1468     1987     2009

                  2023     2461     2600     2652

                  2663     2753     2758     2795

                  2836     2923     2926     2929

                  3165     3261     3302     3316

                  3430     3769     3784     3995

                  4201     4204     4269     4412

                  4567

Bsp120 I    (1)   1319

Bsp1286 I   (1)   2994

BspH I      (2)   2117     3889

BspM I      (3)   2578     2959     3409

Bsr I       (9)   297      795      1721     2399

                  2634     2835     4081     4195

                  4208

BsrB I      (5)   1043     1951     2115     3304

                  3358

BsrD I      (1)   2924

BssH II     (1)   1244

BssS I      (4)   672      3283     3409     4436

BstB I      (2)   1293     3373

BstE II     (2)   740      911

BstN I      (13)  91       284      770      924

                  2227     2282     2299     3078

                  3657     3760     4450     4463

                  4584

BstU I      (19)  61       883      973      1246

                  1317     1579     1615     1991

                  2011     2035     2066     2757

                  3058     3496     3580     3643

                  3712     3985     4566

BstX I      (1)   1142

BstY I      (11)  586      1275     1326     1335

                  2862     3108     3500     3859

                  3871     3957     3968

Bsu36 I     (2)   2171     3803

Cac8 I      (29)  87       280      1246     1319

                  1910     1953     1967     2240

                  2259     2312     2331     2585

                  2771     2990     3056     3062

                  3090     3094     3135     3139

                  3193     3476     3663     3710

                  3766     3788     3999     4559

                  4596

Cfr10 I     (5)   1266     1908     3010     3191

                  3474

Cla I       (1)   2531

Csp6 I      (11)  219      244      299      332

                  383      540      797      1049

                  1238     1312     2996

Dde I       (7)   787      2171     2473     3354

                  3803     3926     4335

Dpn I       (23)  588      684      1080     1277

                  1328     1337     1350     2530

                  2534     2553     2864     2942

                  3023     3032     3110     3486

                  3502     3861     3873     3951

                  3959     3970     4045

DpnII       (23)  586      682      1078     1275

                  1326     1335     1348     2528

                  2532     2551     2862     2940

                  3021     3030     3108     3484

                  3500     3859     3871     3949

                  3957     3968     4043

Dra I       (3)   1393     3835     3854

Dra III     (1)   1807

Drd I       (4)   1125     1762     2718     4507

Dsa I       (6)   361      598      1018     1315

                  2420     3123

Eae I       (7)   668      1109     1144     2597

                  2771     3162     3189

Eag I       (1)   2597

Ear I       (3)   2158     3035     3245

Eco57 I     (7)   755      1088     1112     1118

                  2836     3268     4068

EcoO109 I   (1)   3789

EcoR I      (1)   1295

EcoR II     (13)  89       282      768      922

                  2225     2280     2297     3076

                  3655     3758     4448     4461

                  4582

Ehe I       (4)   1064     1172     1271     2692

Fnu4H I     (37)  704      752      905      969

                  974      1109     1161     1164

                  1256     1468     1987     2009

                  2023     2461     2600     2652

                  2663     2753     2758     2795

                  2836     2923     2926     2929

                  3165     3261     3302     3316

                  3430     3769     3784     3995

                  4201     4204     4269     4412

                  4567

Fok I       (8)   762      819      1058     2364

                  2558     3015     3040     3494

Fsp I       (2)   648      2793

Gdi II      (6)   669      1110     2596     2598

                  3161     3188

Gsu I       (2)   3475     3530

Hae I       (9)   603      810      1032     1146

                  2512     2773     4135     4587

                  4598

Hae II      (7)   1066     1174     1273     1958

                  1966     2694     4369

Hae III     (30)  85       278      603      670

                  703      754      810      997

                  1032     1111     1146     1255

                  1321     1657     1799     2454

                  2460     2469     2512     2599

                  2773     3164     3191     3700

                  3757     3790     4135     4569

                  4587     4598

Hga I       (7)   526      1127     2025     3400

                  3479     3920     4498

HgiA I      (4)   1286     2804     2994     4299

HgiE II     (1)   4020

Hha I       (29)  637      649      883      973

                  1065     1173     1246     1248

                  1272     1957     1965     1991

                  2013     2022     2035     2066

                  2685     2693     2757     2794

                  3060     3320     3496     3582

                  3985     4094     4268     4368

                  4435

HinC II     (2)   1307     1454

Hind II     (2)   1307     1454

HinD III    (1)   1288

Hinf I      (12)  411      927      1734     1756

                  2166     3176     3310     3362

                  3420     3457     4239     4635

HinI I      (12)  123      176      259      445

                  616      1063     1120     1171

                  1270     2691     3393     3472

HinP I      (29)  635      647      881      971

                  1063     1171     1244     1246

                  1270     1955     1963     1989

                  2011     2020     2033     2064

                  2683     2691     2755     2792

                  3058     3318     3494     3580

                  3983     4092     4266     4366

                  4433

Hpa I       (1)   1454

Hpa II      (20)  1168     1267     1323     1333

                  1909     2596     2673     2695

                  2723     2854     2944     3011

                  3192     3467     3475     3567

                  4041     4231     4257     4404

Hph I       (9)   376      751      922      973

                  1194     1809     2870     3761

                  3877

Kas I       (4)   1062     1170     1269     2690

Kpn I       (1)   1315

Mae I       (8)   593      1339     1540     1958

                  2514     3529     3863     4116

Mae II      (16)  123      135      176      259

                  340      445      616      814

                  1751     1763     1806     1916

                  2807     2994     3775     3908

Mae III     (15)  62       149      498      740

                  911      917      1479     1980

                  1992     2811     3117     3807

                  4073     4189     4252

Mbo I       (23)  586      682      1078     1275

                  1326     1335     1348     2528

                  2532     2551     2862     2940

                  3021     3030     3108     3484

                  3500     3859     3871     3949

                  3957     3968     4043

Mbo II      (11)  1021     1024     1946     2174

                  3051     3261     3343     3510

                  3710     3880     3953

Mlu I       (1)   1577

Mme I       (4)   1014     1783     4217     4401

Mnl I       (45)  542      605      613      616

                  647      680      686      692

                  707      795      857      890

                  940      997      1022     1042

                  1049     1081     1118     1208

                  1213     1244     1370     1409

                  1418     1835     2166     2444

                  2450     2473     2479     2487

                  2490     2502     2542     2606

                  2742     3099     3291     3497

                  3529     3811     4181     4432

                  4505

Msc I       (2)   1146     2773

Mse I       (15)  8        1392     1453     1574

                  1595     1606     1618     1629

                  1646     1744     2015     3834

                  3848     3853     3905

Msl I       (2)   366      3128

Msp I       (20)  1168     1267     1323     1333

                  1909     2596     2673     2695

                  2723     2854     2944     3011

                  3192     3467     3475     3567

                  4041     4231     4257     4404

MspA1 I     (6)   1163     1317     2189     2797

                  4026     4271

Mun I       (1)   1441

Nae I       (3)   1910     3193     3476

Nar I       (4)   1063     1171     1270     2691

Nci I       (7)   1168     1323     1324     2695

                  2855     3468     4232

Nco I       (5)   361      598      1018     2420

                  3123

Nde I       (1)   235

NgoM I      (3)   1908     3191     3474

Nla III     (20)  305      365      602      635

                  653      1022     1145     2121

                  2261     2333     2424     2565

                  2910     3096     3127     3153

                  3509     3893     4613     4664

Nla IV      (26)  468      659      719      755

                  803      977      998      1064

                  1172     1271     1313     1321

                  1328     1846     1867     1879

                  2070     2231     2303     2692

                  2727     3575     3654     3699

                  4542     4581

Nsi I       (3)   2263     2335     4666

Nsp7524 I   (4)   2257     2329     3092     4609

NspB II     (6)   1163     1317     2189     2797

                  4026     4271

NspH I      (4)   2261     2333     3096     4613

PaeR7 I     (1)   1279

Pal I       (30)  85       278      603      670

                  703      754      810      997

                  1032     1111     1146     1255

                  1321     1657     1799     2454

                  2460     2469     2512     2599

                  2773     3164     3191     3700

                  3757     3790     4135     4569

                  4587     4598

PflM I      (1)   1024

Ple I       (2)   1742     2174

PspA I      (1)   1322

Pst I       (2)   940      1304

Pvu II      (3)   1163     2189     2797

Rsa I       (11)  220      245      300      333

                  384      541      798      1050

                  1239     1313     2997

Rsr II      (1)   3207

Sac I       (1)   1286

Sac II      (1)   1318

Sal I       (1)   1305

Sap I       (2)   3035     3245

Sau3A I     (23)  586      682      1078     1275

                  1326     1335     1348     2528

                  2532     2551     2862     2940

                  3021     3030     3108     3484

                  3500     3859     3871     3949

                  3957     3968     4043

Sau96 I     (14)  84       277      701      753

                  996      1253     1319     1320

                  1798     3207     3652     3698

                  3756     3789

ScrF I      (20)  91       284      770      924

                  1168     1323     1324     2227

                  2282     2299     2695     2855

                  3078     3468     3657     3760

                  4232     4450     4463     4584

Sec I       (28)  361      598      610      745

                  769      805      862      922

                  1018     1054     1123     1249

                  1315     1322     2225     2297

                  2420     2455     2464     2513

                  2854     3123     3528     3655

                  3656     3758     3759     4449

SfaN I      (11)  359      1506     2269     2341

                  2650     2905     2989     3053

                  3121     3328     4513

Sfc I       (5)   936      1300     2026     4153

                  4344

Sfi I       (1)   2466

Sma I       (1)   1324

SnaB I      (1)   341

Sph I       (3)   2261     2333     3096

Ssp I       (2)   1599     2152

Stu I       (3)   810      1032     2512

Sty I       (9)   361      598      745      805

                  1018     2420     2513     3123

                  3528

Taq I       (17)  679      685      895      1280

                  1293     1306     1840     2531

                  2804     2960     2984     3020

                  3182     3373     3418     3673

                  4511

Tfi I       (5)   3176     3310     3420     3457

                  4635

Tsp45 I     (6)   740      911      917      1980

                  2811     3117

Tth111 I    (1)   2809

Tth111 II   (4)   3127     3987     4017     4026

Vsp I       (1)   8

Xba I       (1)   1338

Xho I       (1)   1279

Xho II      (11)  586      1275     1326     1335

                  2862     3108     3500     3859

                  3871     3957     3968

Xma I       (1)   1322

Xma III     (1)   2597

 

Site usage in pMRFP-C1:

 

Aat II     G,ACGT`C         5     Acc I      GT`MK,AC         1

Acc65 I    G`GTAC,C         1     Aci I      C`CG,C           65

Afl II     C`TTAA,G         -     Afl III    A`CRYG,T         2

Age I      A`CCGG,T         -     Aha II     GR`CG,YC         12

Ahd I      GACNN,N`NNGTC    1     Alu I      AG|CT            20

Alw I      GGATC 8/9        15    AlwN I     CAG,NNN`CTG      2

Apa I      G,GGCC`C         1     ApaL I     G`TGCA,C         1

Apo I      R`AATT,Y         4     Asc I      GG`CGCG,CC       -

Ase I      AT`TA,AT         1     Asp718     G`GTAC,C         1

Ava I      C`YCGR,G         4     Ava II     G`GWC,C          2

Avr II     C`CTAG,G         2     BamH I     G`GATC,C         1

Ban I      G`GYRC,C         10    Ban II     G,RGCY`C         6

Bbe I      G,GCGC`C         4     Bbs I      GAAGAC 8/12      1

Bbv I      GCAGC 13/17      7     Bbv II     GAAGAC 7/11      1

Bcl I      T`GATC,A         1     Bcn I      CC,S`GG          7

Bfa I      C`TA,G           8     Bgl I      GCCN,NNN`NGGC    4

Bgl II     A`GATC,T         1     Blp I      GC`TNA,GC        -

Bpm I      CTGGAG 22/20     2     Bsa I      GGTCTC 7/11      1

BsaA I     YAC|GTR          4     BsaB I     GATNN|NNATC      2

BsaH I     GR`CG,YC         12    BsaJ I     C`CNNG,G         28

BsaW I     W`CCGG,W         5     BseR I     GAGGAG 16/14     3

Bsg I      GTGCAG 22/20     1     BsiC I     TT`CG,AA         2

BsiE I     CG,RY`CG         2     BsiHKA I   G,WGCW`C         4

BsiW I     C`GTAC,G         -     Bsm I      GAATG,C 7        2

BsmA I     GTCTC`/9         5     BsmB I     CGTCTC 7/11      -

BsmF I     GGGAC 15/19      12    BsoF I     GC`N,GC          37

Bsp120 I   G`GGCC,C         1     Bsp1286 I  G,DGCH`C         1

BspH I     T`CATG,A         2     BspM I     ACCTGC 10/14     3

BspM II    T`CCGG,A         -     Bsr I      ACT,GG`          9

BsrB I     GAG|CGG          5     BsrD I     GCAATG, 8        1

BsrG I     T`GTAC,A         -     BssH II    G`CGCG,C         1

BssS I     C`TCGT,G         4     Bst1107 I  GTA|TAC          -

BstB I     TT`CG,AA         2     BstE II    G`GTNAC,C        2

BstN I     CC`W,GG          13    BstU I     CG|CG            19

BstX I     CCAN,NNNN`NTGG   1     BstY I     R`GATC,Y         11

Bsu36 I    CC`TNA,GG        2     Cac8 I     GCN|NGC          29

Cfr10 I    R`CCGG,Y         5     Cla I      AT`CG,AT         1

Csp6 I     G`TA,C           11    Dde I      C`TNA,G          7

Dpn I      GA|TC            23    DpnII      `GATC,           23

Dra I      TTT|AAA          3     Dra III    CAC,NNN`GTG      1

Drd I      GACNN,NN`NNGTC   4     Dsa I      C`CRYG,G         6

Eae I      Y`GGCC,R         7     Eag I      C`GGCC,G         1

Ear I      CTCTTC 7/10      3     Eco47 III  AGC|GCT          -

Eco57 I    CTGAAG 21/19     7     Eco72 I    CAC|GTG          -

EcoN I     CCTNN`N,NNAGG    -     EcoO109 I  RG`GNC,CY        1

EcoR I     G`AATT,C         1     EcoR II    `CCWGG,          13

EcoR V     GAT|ATC          -     Ehe I      GGC|GCC          4

Esp I      GC`TNA,GC        -     Fnu4H I    GC`N,GC          37

Fok I      GGATG 14/18      8     Fse I      GG,CCGG`CC       -

Fsp I      TGC|GCA          2     Gdi II     `YGGC,CG         6

Gsu I      CTGGAG 21/19     2     Hae I      WGG|CCW          9

Hae II     R,GCGC`Y         7     Hae III    GG|CC            30

Hga I      GACGC 9/14       7     HgiA I     G,WGCW`C         4

HgiE II    ACCNNNNNNGGT -1/131     Hha I      G,CG`C           29

HinC II    GTY|RAC          2     Hind II    GTY|RAC          2

HinD III   A`AGCT,T         1     Hinf I     G`ANT,C          12

HinI I     GR`CG,YC         12    HinP I     G`CG,C           29

Hpa I      GTT|AAC          1     Hpa II     C`CG,G           20

Hph I      GGTGA 12/11      9     Kas I      G`GCGC,C         4

Kpn I      G,GTAC`C         1     Mae I      C`TA,G           8

Mae II     A`CG,T           16    Mae III    `GTNAC,          15

Mbo I      `GATC,           23    Mbo II     GAAGA 12/11      11

Mlu I      A`CGCG,T         1     Mme I      TCCRAC 25/23     4

Mnl I      CCTC 10/10       45    Msc I      TGG|CCA          2

Mse I      T`TA,A           15    Msl I      CAYNN|NNRTG      2

Msp I      C`CG,G           20    MspA1 I    CMG|CKG          6

Mun I      C`AATT,G         1     Nae I      GCC|GGC          3

Nar I      GG`CG,CC         4     Nci I      CC`S,GG          7

Nco I      C`CATG,G         5     Nde I      CA`TA,TG         1

NgoM I     G`CCGG,C         3     Nhe I      G`CTAG,C         -

Nla III    ,CATG`           20    Nla IV     GGN|NCC          26

Not I      GC`GGCC,GC       -     Nru I      TCG|CGA          -

Nsi I      A,TGCA`T         3     Nsp7524 I  R`CATG,Y         4

NspB II    CMG|CKG          6     NspH I     R,CATG`Y         4

PaeR7 I    C`TCGA,G         1     Pal I      GG|CC            30

PflM I     CCAN,NNN`NTGG    1     Ple I      GAGTC 9/10       2

Pme I      CTTT|AAAC        -     Pml I      CAC|GTG          -

PpuM I     RG`GWC,CY        -     Psp1406 I  AA`CG,TT         -

PspA I     C`CCGG,G         1     Pst I      C,TGCA`G         2

Pvu I      CG,AT`CG         -     Pvu II     CAG|CTG          3

Rsa I      GT|AC            11    Rsr II     CG`GWC,CG        1

Sac I      G,AGCT`C         1     Sac II     CC,GC`GG         1

Sal I      G`TCGA,C         1     Sap I      GCTCTTC 8/11     2

Sau3A I    `GATC,           23    Sau96 I    G`GNC,C          14

Sca I      AGT|ACT          -     ScrF I     CC`N,GG          20

Sec I      C`CNNG,G         28    SfaN I     GCATC 9/13       11

Sfc I      C`TRYA,G         5     Sfi I      GGCCN,NNN`NGGCC  1

Sma I      CCC|GGG          1     SnaB I     TAC|GTA          1

Spe I      A`CTAG,T         -     Sph I      G,CATG`C         3

Spl I      C`GTAC,G         -     Srf I      GCCC|GGGC        -

Ssp I      AAT|ATT          2     Stu I      AGG|CCT          3

Sty I      C`CWWG,G         9     Taq I      T`CG,A           17

Tfi I      G`AWT,C          5     Tsp45 I    `GTSAC,          6

Tth111 I   GACN`N,NGTC      1     Tth111 II  CAARCA 16/14     4

Vsp I      AT`TA,AT         1     Xba I      T`CTAG,A         1

Xca I      GTA|TAC          -     Xcm I      CCANNNN,N`NNNNTGG-

Xho I      C`TCGA,G         1     Xho II     R`GATC,Y         11

Xma I      C`CCGG,G         1     Xma III    C`GGCC,G         1